circad | circRNAs associated with diseases

hsa_circ_0007534
Gene	DDX42	Organism	Human
Genome Locus	chr17:61869771-61877977:+	Build	hg19
Disease	Non small cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29364478
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	98 pairs of NSCLC tissues and adjacent non-tumor tissue samples
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTGACGGAAATCCAATTGCACC Reverse ATGGAATTGCTGGCGAGTTG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhang, R, Xu, J, Zhao, J, Wang, X (2018). Silencing of hsa_circ_0007534 suppresses proliferation and induces apoptosis in colorectal cancer cells. Eur Rev Med Pharmacol Sci, 22, 1:118-126.